Review



partial lck 135 bp egfp sequences  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc partial lck 135 bp egfp sequences
    Partial Lck 135 Bp Egfp Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/partial+lck+135+bp+egfp+sequences/pBOB-Lck-GFP+(Plasmid+%23118738)/10__1002_slash_admi__202500806-298-6-15
    Average 94 stars, based on 3 article reviews
    partial lck 135 bp egfp sequences - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Construct:

    Article Title: Cholesterol‐DNA Origami Nanostructures for Synthetic Lipid Rafts Induce Early T Cell Activation Signals
    Article Snippet: .. To construct the lentiviral pLV-Lck-GFP plasmid, partial Lck (135 bp)-EGFP sequences were amplified from pBOB-Lck-GFP (Addgene # 118738) using PCR with the following primers: forward: 5’-cgggcctttcgaattccgctgttttgacctccat-3’ and reverse: 5’- gtgggagttgcggccgctcagcattggtagctgct -3’. .. The lentiviral vector pHR_PGK_antiCD19_synNotch_Gal4VP64 (Addgene # 79125) was digested with EcoRI and NotI, and then ligated with the amplified sequences.

    Plasmid Preparation:

    Article Title: Cholesterol‐DNA Origami Nanostructures for Synthetic Lipid Rafts Induce Early T Cell Activation Signals
    Article Snippet: .. To construct the lentiviral pLV-Lck-GFP plasmid, partial Lck (135 bp)-EGFP sequences were amplified from pBOB-Lck-GFP (Addgene # 118738) using PCR with the following primers: forward: 5’-cgggcctttcgaattccgctgttttgacctccat-3’ and reverse: 5’- gtgggagttgcggccgctcagcattggtagctgct -3’. .. The lentiviral vector pHR_PGK_antiCD19_synNotch_Gal4VP64 (Addgene # 79125) was digested with EcoRI and NotI, and then ligated with the amplified sequences.

    Amplification:

    Article Title: Cholesterol‐DNA Origami Nanostructures for Synthetic Lipid Rafts Induce Early T Cell Activation Signals
    Article Snippet: .. To construct the lentiviral pLV-Lck-GFP plasmid, partial Lck (135 bp)-EGFP sequences were amplified from pBOB-Lck-GFP (Addgene # 118738) using PCR with the following primers: forward: 5’-cgggcctttcgaattccgctgttttgacctccat-3’ and reverse: 5’- gtgggagttgcggccgctcagcattggtagctgct -3’. .. The lentiviral vector pHR_PGK_antiCD19_synNotch_Gal4VP64 (Addgene # 79125) was digested with EcoRI and NotI, and then ligated with the amplified sequences.

    Polymerase Chain Reaction:

    Article Title: Cholesterol‐DNA Origami Nanostructures for Synthetic Lipid Rafts Induce Early T Cell Activation Signals
    Article Snippet: .. To construct the lentiviral pLV-Lck-GFP plasmid, partial Lck (135 bp)-EGFP sequences were amplified from pBOB-Lck-GFP (Addgene # 118738) using PCR with the following primers: forward: 5’-cgggcctttcgaattccgctgttttgacctccat-3’ and reverse: 5’- gtgggagttgcggccgctcagcattggtagctgct -3’. .. The lentiviral vector pHR_PGK_antiCD19_synNotch_Gal4VP64 (Addgene # 79125) was digested with EcoRI and NotI, and then ligated with the amplified sequences.



    Similar Products

    partial lck 135 bp egfp sequences  (Addgene inc)
    94
    Addgene inc partial lck 135 bp egfp sequences
    Partial Lck 135 Bp Egfp Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/partial+lck+135+bp+egfp+sequences/pBOB-Lck-GFP+(Plasmid+%23118738)/10__1002_slash_admi__202500806-298-6-15
    Average 94 stars, based on 1 article reviews
    partial lck 135 bp egfp sequences - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier

    Image Search Results